USA USA: 1-631-626-9181 Europe Europe: 44-207-097-1828  


Tissue samples, tissue arrays, cells, microorganisms, probes and services for your research.

Web Search    Google
Featured Products
Ordering Information

Payment methods we support:
✭ Invoice / Purchase Order
✭ Credit card

DSV698 Probe

  • Specification
  • Recommended Products
The identification of microbes: Desulfovibrio sp; Sequence: GTTCCTCCAGATATCTACGG
50 Tests
warningFor Research Use Only. Not for use in diagnostic procedures.
Store at minus 20 centigrade
Citation Guidance
If you use this products in your scientific publication, it should be cited in the publication as: Creative Bioarray cat no. If your paper has been published, please click here to submit the Pub Med ID of your paper to get a coupon.
Customer Support & Price Inquiry
Please input "bioarray" as verification code.
45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828

Tel: 44-207-097-1828