Bacterial Probes
Since the microbial specificity of periodontal diseases is well established, having a valid microbial diagnostic test is essential for a correct and a coherent treatment planning. DNA probe will be used to identify and quantify the oral pathogens, most commonly associated with periodontitis. Oligodeoxynucleotide probes have been developed for identification of the periodontal bacteria Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, B. intermedius types I and II, B. forsythus, Eikenella corrodens, Fusobacterium nucleatum, Haemophilus aphrophilus, Streptococcus intermedius, and Wolinella recta.
FISH Probes were designed by sequencing the 16S rRNA for each bacterium, identifying hypervariable regions, and chemically synthesizing species-specific probes. These probes were specific when tested against a panel of nucleic acids from closely related bacteria.
Our specialists from Creative Bioarray have developed a more rapid identification assay using species- or genus-specific probes. Creative Bioarray is one of the well-recognized experts who is professional in FISH technologies for a broad range of project objective. With years of experience, our scientists can offer high-quality FISH analysis of microorganisms to meet your demands.
Description: The identification of microbes: Genus Thermoanaerobacterium; Sequence: TGGGACCTGTTTTCTGGG
Description: The identification of microbes: Thermoanaerobacterium; Sequence: GCGATGCCGCTTCTCGAC
Description: The identification of microbes: α-Proteobacteria; Sequence: GGTAAGGTTCTGCGCGTT
Description: The identification of microbes: Archaea; Sequence: GTGCTCCCCCGCCAATTCCT
Description: The identification of microbes: Genus Caldicellulosiruptor; Sequence: CTCCCCGTCCAAAGAGGT
Description: The identification of microbes: Desulfosarcina, Desulfococcus; Sequence: TCCACTTCCCTCTCCCAT
Description: The identification of microbes: Desulfovibrio sp; Sequence: GTTCCTCCAGATATCTACGG
Description: The identification of microbes: Most bacteria; Sequence: GCTGCCTCCCGTAGGAGT
Description: The identification of microbes: anaerobic ammonium-oxidizing bacteria, Candidatus Brocadia ...
Description: The identification of microbes: Aplasma, acid mine drainage Thermoplasmatales
Description: The identification of microbes: Aquabacterium spp.
Description: The identification of microbes: Aquificales
Description: The identification of microbes: Aquificales
Description: The identification of microbes: Arcanocterium pyogenes
Description: The identification of microbes: Archaea
Description: The identification of microbes: Archaeoglobales