MS1414 Probe
- Specification
- Q & A
- Customer Review
Cat.No.
FBPC-30
Description
The identification of microbes: Methanosarcinales (except Methanosaeta);
Sequence: CTCACCCATACCTCACTCGGG
Size
50 Tests
Usage
For Research Use Only. Not for use in diagnostic procedures.Storage
Store at minus 20 centigrade
Citation Guidance
If you use this products in your scientific publication, it should be cited in the publication as: Creative Bioarray cat no.
If your paper has been published, please click here
to submit the PubMed ID of your paper to get a coupon.
Ask a Question
Write your own review
Featured Products
- Adipose Tissue-Derived Stem Cells
- Human Neurons
- Mouse Probe
- Whole Chromosome Painting Probes
- Hepatic Cells
- Renal Cells
- In Vitro ADME Kits
- Tissue Microarray
- Tissue Blocks
- Tissue Sections
- FFPE Cell Pellet
- Probe
- Centromere Probes
- Telomere Probes
- Satellite Enumeration Probes
- Subtelomere Specific Probes
- Bacterial Probes
- ISH/FISH Probes
- Exosome Isolation Kit
- Human Adult Stem Cells
- Mouse Stem Cells
- iPSCs
- Mouse Embryonic Stem Cells
- iPSC Differentiation Kits
- Mesenchymal Stem Cells
- Immortalized Human Cells
- Immortalized Murine Cells
- Cell Immortalization Kit
- Adipose Cells
- Cardiac Cells
- Dermal Cells
- Epidermal Cells
- Peripheral Blood Mononuclear Cells
- Umbilical Cord Cells
- Monkey Primary Cells
- Mouse Primary Cells
- Breast Tumor Cells
- Colorectal Tumor Cells
- Esophageal Tumor Cells
- Lung Tumor Cells
- Leukemia/Lymphoma/Myeloma Cells
- Ovarian Tumor Cells
- Pancreatic Tumor Cells
- Mouse Tumor Cells
Hot Products