Bacterial Probes
Since the microbial specificity of periodontal diseases is well established, having a valid microbial diagnostic test is essential for a correct and a coherent treatment planning. DNA probe will be used to identify and quantify the oral pathogens, most commonly associated with periodontitis. Oligodeoxynucleotide probes have been developed for identification of the periodontal bacteria Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, B. intermedius types I and II, B. forsythus, Eikenella corrodens, Fusobacterium nucleatum, Haemophilus aphrophilus, Streptococcus intermedius, and Wolinella recta.
FISH Probes were designed by sequencing the 16S rRNA for each bacterium, identifying hypervariable regions, and chemically synthesizing species-specific probes. These probes were specific when tested against a panel of nucleic acids from closely related bacteria.
Our specialists from Creative Bioarray have developed a more rapid identification assay using species- or genus-specific probes. Creative Bioarray is one of the well-recognized experts who is professional in FISH technologies for a broad range of project objective. With years of experience, our scientists can offer high-quality FISH analysis of microorganisms to meet your demands.
Description: The identification of microbes: Desulfofrigus, Desulfofaba gelida, Desulfomusa hansenii
Description: The identification of microbes: Methanosarcinales; Sequence: CTCACCCATACCTCACTCGGG
Description: The identification of microbes: Desulfomicrobium
Description: The identification of microbes: Desulfomonile-related Lake Cadagno clone 650
Description: The identification of microbes: Desulfomonile-related Lake Cadagno clones 618, 624, 626 and 651
Description: The identification of microbes: Desulfosarcina and many other Desulfobacteraceae
Description: The identification of microbes: Desulfosarcina variabilis
Description: The identification of microbes: Desulfosarcina, Desulfococcus
Description: The identification of microbes: Desulfosarcina/Desulfococcs subgroup SEEP-SRB1a (ANME-2 partner)
Description: The identification of microbes: Desulfosarcina/Desulfococcs subgroup SEEP-SRB1a (ANME-2 partner)
Description: The identification of microbes: Desulfosarcina/Desulfococcs subgroup SEEP-SRB1f
Description: The identification of microbes: Desulfotomaculum cluster I and other Firmicutes
Description: The identification of microbes: Methanosarcinales (except Methanosaeta); Sequence: ...
Description: The identification of microbes: Desulfotomaculum cluster I and other Firmicutes
Description: The identification of microbes: Desulfotomaculum subcluster lh (Pelotomaculum and Cryptanaerobacter)
Description: The identification of microbes: Desulfovibrio acrylicus
Description: The identification of microbes: Desulfovibrio aestuarii
Description: The identification of microbes: Desulfovibrio sp.