Bacterial Probes
Since the microbial specificity of periodontal diseases is well established, having a valid microbial diagnostic test is essential for a correct and a coherent treatment planning. DNA probe will be used to identify and quantify the oral pathogens, most commonly associated with periodontitis. Oligodeoxynucleotide probes have been developed for identification of the periodontal bacteria Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, B. intermedius types I and II, B. forsythus, Eikenella corrodens, Fusobacterium nucleatum, Haemophilus aphrophilus, Streptococcus intermedius, and Wolinella recta.
FISH Probes were designed by sequencing the 16S rRNA for each bacterium, identifying hypervariable regions, and chemically synthesizing species-specific probes. These probes were specific when tested against a panel of nucleic acids from closely related bacteria.
Our specialists from Creative Bioarray have developed a more rapid identification assay using species- or genus-specific probes. Creative Bioarray is one of the well-recognized experts who is professional in FISH technologies for a broad range of project objective. With years of experience, our scientists can offer high-quality FISH analysis of microorganisms to meet your demands.
Description: The identification of microbes: Crenarchaea
Description: The identification of microbes: Crenthrix polyspora
Description: The identification of microbes: Crenthrix polyspora sequence cluster I
Description: The identification of microbes: Crenothrix polyspora sequence cluster I-II
Description: The identification of microbes: Methanobacteriales (except Methanothermaceae); Sequence: ...
Description: The identification of microbes: Crenothrix polyspora sequence cluster III-IV
Description: The identification of microbes: Crenothrix polyspora sequence cluster II-IV
Description: The identification of microbes: Criblamydia sequanensis
Description: The identification of microbes: Cytophaga spp.
Description: The identification of microbes: Cytophaga spp.
Description: The identification of microbes: D.vanus
Description: The identification of microbes: Defluvicoccus vanus-related organisms, cluster 2
Description: The identification of microbes: Defluviicoccus related organisms, cluster III
Description: The identification of microbes: Defluviicoccus related organisms, some cluster III
Description: The identification of microbes: Defluviicoccus related organisms, some cluster IV
Description: The identification of microbes: Methanococcales; Sequence: GCAACATAGGGCACGGGTCT
Description: The identification of microbes: Defluviicoccus related organisms, some cluster III
Description: The identification of microbes: Defluviicoccus related organisms, some cluster IV