Bacterial Probes
Since the microbial specificity of periodontal diseases is well established, having a valid microbial diagnostic test is essential for a correct and a coherent treatment planning. DNA probe will be used to identify and quantify the oral pathogens, most commonly associated with periodontitis. Oligodeoxynucleotide probes have been developed for identification of the periodontal bacteria Actinobacillus actinomycetemcomitans, Bacteroides gingivalis, B. intermedius types I and II, B. forsythus, Eikenella corrodens, Fusobacterium nucleatum, Haemophilus aphrophilus, Streptococcus intermedius, and Wolinella recta.
FISH Probes were designed by sequencing the 16S rRNA for each bacterium, identifying hypervariable regions, and chemically synthesizing species-specific probes. These probes were specific when tested against a panel of nucleic acids from closely related bacteria.
Our specialists from Creative Bioarray have developed a more rapid identification assay using species- or genus-specific probes. Creative Bioarray is one of the well-recognized experts who is professional in FISH technologies for a broad range of project objective. With years of experience, our scientists can offer high-quality FISH analysis of microorganisms to meet your demands.
Description: The identification of microbes: Deltaproteobacterial symbiont 1 of Olavius crassitunicatus
Description: The identification of microbes: Deltaproteobacterial symbiont 2 of Olavius crassitunicatus
Description: The identification of microbes: Deltaproteobacterial symbiont 3 of Olavius crassitunicatus
Description: The identification of microbes: Deltaproteobacterial symbiont of Olavius algarvensis
Description: The identification of microbes: Desulfarculus baarsii, Desulfomonile tiedjei, and Syntrophus
Description: The identification of microbes: Desufobacca acetoxidans
Description: The identification of microbes: Desulfobacter, Desulfobacula, Desulfospira, and Desulfotignum
Description: The identification of microbes: Desulfobacteraceae and other Bacteria
Description: The identification of microbes: Methanomicrobiales; Sequence: CGGATAATTCGGGGCATGCTG
Description: The identification of microbes: Desulfobacterales, Desulfuromonales, Syntrophobacterales, ...
Description: The identification of microbes: Desulfobacterium catecholicum and related strains LacK1 and LacK9.
Description: The identification of microbes: Desulfobacterium catecholicum and related strains LacK1 and LacK9.
Description: The identification of microbes: Desulfobacterium catecholicum-related strains LacK1, LacK4 and ...
Description: The identification of microbes: Desulfobacterium vacuolatum D.niacini, D, autotrophicum
Description: The identification of microbes: Desulfobotulus sapovorans, Desulfovibrio fairfieldensis, and other ...
Description: The identification of microbes: Desulfocapsa thiozymogenes
Description: The identification of microbes: Desulfococcus multivorans
Description: The identification of microbes: Desulfococcus/Desulfosarcina/Desulfonema