Our Promise to You

Guaranteed product quality, expert customer support

Our Promise to You

MS1414 Probe

  • Specification
  • Recommended Products
Cat.No.
FBPC-30
Description
The identification of microbes: Methanosarcinales (except Methanosaeta); Sequence: CTCACCCATACCTCACTCGGG
Size
50 Tests
Usage
warningFor Research Use Only. Not for use in diagnostic procedures.
Storage
Store at minus 20 centigrade
Citation Guidance
If you use this products in your scientific publication, it should be cited in the publication as: Creative Bioarray cat no. If your paper has been published, please click here to submit the PubMed ID of your paper to get a coupon.

For research use only. Not for any other purpose.

  • Q & A
  • Customer Review

Ask a Question

Write your own review

Customer Support & Price Inquiry

Verification Code