Online Inquiry & Support

USA: 1-631-626-9181   Fax: 1-631-614-7828
Europe: 44-207-048-3343

MG1200 Probe

Bookmark and Share
  • Cat.No.
  • FBPC-28
  • Description
  • The identification of microbes: Methanomicrobiales; Sequence: CGGATAATTCGGGGCATGCTG
  • Size
  • 50 Tests
  • Storage
  • Store at minus 20 centigrade
  • Usage
  • warningFor Research Use Only. Not for use in diagnostic procedures.


Please input "bioarray" as verification code.


tissue samples, tissue arrays, cells, microorganisms, probes and services for your research.



Contact Us
45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828

Tel: 44-207-048-3343