Featured Products
- EUB338 Probe
- WCP 1 FISH Probe
- WCP 2 FISH Probe
- WCP 5 FISH Probe
- WCP 7 FISH Probe
- WCP 11 FISH Probe
- WCP 17 FISH Probe
- WCP Y FISH Probe
- Mouse Chromosome 2 Point Probe
- Mouse Chromosome 4 Point Probe
- Mouse Chromosome 5 Point Probe
- Mouse Chromosome 9 Point Probe
- Mouse Chromosome 11 Point Probe
- Mouse Chromosome 12 Point Probe
- Mouse Chromosome 14 Point Probe
- Mouse Chromosome 15 Point Probe
- Mouse Chromosome 16 Point Probe
- Mouse Chromosome 18 Point Probe
Our Promise to You
Guaranteed product quality, expert customer support
MG1200 Probe
- Specification
- Recommended Products
Cat.No.
FBPC-28
Description
The identification of microbes: Methanomicrobiales;
Sequence: CGGATAATTCGGGGCATGCTG
Size
50 Tests
Usage
For Research Use Only. Not for use in diagnostic procedures.
Storage
Store at minus 20 centigrade
Citation Guidance
If you use this products in your scientific publication, it should be cited in the publication as: Creative Bioarray cat no. If your paper has been published, please click here to submit the PubMed ID of your paper to get a coupon.
- Q & A
- Customer Review
Customer Support & Price Inquiry