Online Inquiry & Support

USA: 1-631-626-9181   Fax: 1-631-614-7828
Europe: 44-207-097-1828

ARC915 Probe

Bookmark and Share
  • Specification
  • Review & FAQ
  • Recommended Products
  • Cat.No.
  • FBPC-05
  • Description
  • The identification of microbes: Archaea; Sequence: GTGCTCCCCCGCCAATTCCT
  • Size
  • 50 Tests
  • Storage
  • Store at minus 20 centigrade
  • Usage
  • warningFor Research Use Only. Not for use in diagnostic procedures.

Citation Guidance:
If you use this products in your scientific publication, it should be cited in the publication as: Creative Bioarray cat no. If your paper has been published, please click here to submit the Pub Med ID of your paper to get a coupon.

Price Inquiry

Please input "bioarray" as verification code.


tissue samples, tissue arrays, cells, microorganisms, probes and services for your research.



Contact Us
    • USA
      45-1 Ramsey Road, Shirley, NY 11967, USA
      Tel: 1-631-626-9181
      Fax: 1-631-614-7828
      Tel: 44-207-097-1828
Ordering Information
    • Payment methods we support:
      ✭ Invoice / Purchase Order
      ✭ Credit card
Contact Us
45-1 Ramsey Road, Shirley, NY 11967, USA
Tel: 1-631-626-9181
Fax: 1-631-614-7828

Tel: 44-207-097-1828